NOTICE

Since version 1.2.0 This library requires you to use node 6+

Update

while I haven't had any time to work on this, I plan to start Soon(ish) with the version 2 of this library which means it will be rewritten from scratch and I hope to include many options more, this is a package I develop on my free time so if you think you can help me on this feel free to do so!

Hello everyone!

Welcome to DNA-RNA-Protein Translator or if you may drptranslator I have a very bad problem of naming but don't let that stop you!

DRPTranslator is a small library written in typescript, this is intended for a really low entry level of genetics, nothing really advanced since I'm not a genetist after all. However if you want this to help someone at school this can suit you well :)

At the moment these are some of the usages of the principal uses:

• Translate a DNA sequence into a RNA sequence
• Obtain the complementary DNA sequence from another DNA sequence
• Translate directly from DNA to an Aminoacid sequence
• Translate RNA to an Aminoacid sequence
• Find starts and stops codons in a sequence

and some other cool stuff like a obtaining a codon array or find the first and last start and stop sequence.

Install

how can you consume this library? this is intended to be used in a nodejs environment so you can install it as a dependency

npm install --save drptranslator

Usage

Javascript

var drptranslator = require('drptranslator');//this is a must
var RNATranslator = drptranslator.RNATranslator;
var rnaTranslator = new RNATranslator();

var aaSeq = rnaTranslator.transRNAtoAA("AUGGUCUGC");// Met-Val-Cys
console.log(aaSeq);

Typescript

import * as drptranslator from "drptranslator";

var RNATranslator = drptranslator.RNATranslator;
var rnaTrans = new RNATranslator();

var rnatodna = rnaTrans.transRNAtoDNA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
var arnAASeq = rnaTrans.transRNAtoAA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
console.log(arnAASeq, rnatodna);

var DNATranslator = drptranslator.DNATranslator;
var dnaTrans = new DNATranslator();
var dnaAASeq = dnaTrans.transDNAtoAA("GGCTAGCTAGCGCTAGCTAGAACGAGT");
console.log(dnaAASeq);

// console output
// Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser GGCTAGCTAGCGCTAGCTAGAACGAGT
// Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser

What's next?

• [x] Document source files
• [x] Creating a website for its API docs
• [ ] Adding more cappabilities
• [x] Publish a demo of an app using the library Take a look Here and Here

Suggestions

If you have an idea or you want to help to make this something bigger, raise an issue :) I'm glad to check out your ideas!