Class RNATranslator

Given a RNA string, this method will chop the RNA string into the First Start and the First STOP codon's available in the string Given AGAUGCUGCUGCAGU the string returned will be AUGCUGCUGCAGU or Given AGAUGGUAUAGCUGCUGCAGU the string returned will be AUGGUAUAG Given the case without any Start or STOP codons, the string will be unmodified. NEW The parameters start and stop have been added which in turn will let you decide whether you want to include full starts or full stops, notice however that the sequence will be different if you put starts=true & stops=true, for example:

findSeqStartAndStop("AAAAUGACGAUG", true); // starts = [3, 9] -> AUGACGAUG
findSeqStartAndStop("CGAUGCGUAUGCGCG", true) // starts = [2,8] -> AUGCGUAUGCGCG
findSeqStartAndStop("AAAAUGACGAUG", false); // starts = [] -> AAAAUGACGAUG
findSeqStartAndStop("CGAUGCGUAUGCGCG", false) // starts = [] -> CGAUGCGUAUGCGCG

This method returns an array of positions where start sequences are this method could be useful if you need to identify if ther are any repeated start codons in a sequence or if you need to translate a sequence from different start codons.

This method will find any stop codons in a RNA string,

Given a RNA string, this method will convert any codons available in the string however this method will try to translate a sequence from the first start codon and the first STOP codon Given AGAUGCUGCUGCAGU the string used for the translation will be AUGCUGCUGCAGU or Given AGAUGGUAUAGCUGCUGCAGU the string for translation will be AUGGUAUAG

This method is a quite tricky to implement, while some schools will say you have to read all the chain with it's multiple stop codons, some will tell you there's only one start and stop codon the new approach here is to let you decide whether you want to include all starts or all stops or both.